Sequence

CGAUCGAUAAACCUCUGCAUCC

Expression details
CountSample IDExperiment title
4GSM506683Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM118372High-throughput sequencing of small RNAs from Arabidopsis thaliana
2GSM605661Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM253622Small RNAs in four Argonaute complexes in Arabidopsis
1GSM442935Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM506673Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM512703Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM518460small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM605658Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM605662Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0