Sequence

AAUCGAUCGAUAAACCUCUGCAUC

Expression details
CountSample IDExperiment title
5GSM707687Characterization of AGO1-/AGO4-associated smRNAs
2GSM506675Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM605665Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
2GSM707679Characterization of AGO1-/AGO4-associated smRNAs
2GSM707684Characterization of AGO1-/AGO4-associated smRNAs
2GSM707688Characterization of AGO1-/AGO4-associated smRNAs
1GSM442935Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM506659Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM707678Characterization of AGO1-/AGO4-associated smRNAs
1GSM707681Characterization of AGO1-/AGO4-associated smRNAs
1GSM707686Characterization of AGO1-/AGO4-associated smRNAs
1GSM707691Characterization of AGO1-/AGO4-associated smRNAs